renilla plasmid Search Results


93
Addgene inc nsii sali sites
Nsii Sali Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nsii sali sites/product/Addgene inc
Average 93 stars, based on 1 article reviews
nsii sali sites - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc renilla luciferase plasmids
Figure 5. AhR activation promotes the expression of α-defensin 1 via transcriptional binding of AhR to a DRE3 on α-defensin 1 promoter. (a) Identification of three DREs in α-defensin 1 promoter by in silico analysis. (b) 15p-1 and MC38 cells were transfected with pGL3-DRE1, pGL3-DRE2, pGL3-DRE3, and pGL3-DRE1 + 2 + 3 <t>luciferase</t> reporter plasmid and then treated with I3C and DSS at indicated concentration for 16hrs and luciferase reporter assays were performed (n = 4). (c) Same as A and B, but MC38 cells transiently transfected with AhR siRNA or control siRNA were used (n = 4). (d) The transfection efficiency of the reporter assay for AhR siRNA was measured via western blotting analysis with antibodies against AhR (upper panel) and RT-PCR analysis of AhR mRNA expression (bottom panel). All luciferase assays were normalized for transfection efficiency by <t>renilla</t> reporter activity. The results shown are a representative of four independent experiments performed each time in triplicate. (e) ChIP assay using AhR antibody
Renilla Luciferase Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renilla luciferase plasmids/product/Addgene inc
Average 93 stars, based on 1 article reviews
renilla luciferase plasmids - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc renilla luciferase
Figure 5. AhR activation promotes the expression of α-defensin 1 via transcriptional binding of AhR to a DRE3 on α-defensin 1 promoter. (a) Identification of three DREs in α-defensin 1 promoter by in silico analysis. (b) 15p-1 and MC38 cells were transfected with pGL3-DRE1, pGL3-DRE2, pGL3-DRE3, and pGL3-DRE1 + 2 + 3 <t>luciferase</t> reporter plasmid and then treated with I3C and DSS at indicated concentration for 16hrs and luciferase reporter assays were performed (n = 4). (c) Same as A and B, but MC38 cells transiently transfected with AhR siRNA or control siRNA were used (n = 4). (d) The transfection efficiency of the reporter assay for AhR siRNA was measured via western blotting analysis with antibodies against AhR (upper panel) and RT-PCR analysis of AhR mRNA expression (bottom panel). All luciferase assays were normalized for transfection efficiency by <t>renilla</t> reporter activity. The results shown are a representative of four independent experiments performed each time in triplicate. (e) ChIP assay using AhR antibody
Renilla Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renilla luciferase/product/Addgene inc
Average 93 stars, based on 1 article reviews
renilla luciferase - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc renilla reporter plasmid

Renilla Reporter Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renilla reporter plasmid/product/Addgene inc
Average 92 stars, based on 1 article reviews
renilla reporter plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc pis1 eef25utr renilla

Pis1 Eef25utr Renilla, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pis1 eef25utr renilla/product/Addgene inc
Average 93 stars, based on 1 article reviews
pis1 eef25utr renilla - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc pcopia renilla

Pcopia Renilla, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcopia renilla/product/Addgene inc
Average 92 stars, based on 1 article reviews
pcopia renilla - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

92
Addgene inc primers

Primers, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers/product/Addgene inc
Average 92 stars, based on 1 article reviews
primers - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc pgl3basic luciferase

Pgl3basic Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgl3basic luciferase/product/Addgene inc
Average 93 stars, based on 1 article reviews
pgl3basic luciferase - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc renilla plasmid

Renilla Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renilla plasmid/product/Addgene inc
Average 92 stars, based on 1 article reviews
renilla plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

88
Addgene inc renilla luciferase constructs

Renilla Luciferase Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renilla luciferase constructs/product/Addgene inc
Average 88 stars, based on 1 article reviews
renilla luciferase constructs - by Bioz Stars, 2026-04
88/100 stars
  Buy from Supplier

92
Addgene inc 3xdbe re
(A) DNA parts and destination vectors (Table 1) are ordered from the nonprofit plasmid repository Addgene as bacterial stabs, streaked on bacterial plates, grown up in culture, and prepared according to Basic Protocol 1. (B) DNA parts include pathway response elements consisting of a transcription blocker coupled to transcriptional response elements that can bind transcription factors specific for cellular pathways (e.g., NF-κβ, TGF-β, MAPK/JNK, c-Myc, or p53), five orthogonal luciferases (RedF, FLuc, NLuc, Renilla, and GrRenilla), and the transcriptional terminator/polyadenylation signal from the bovine growth hormone gene (bGHpA). Note that improved TGF-β and c-Myc pathway luciferase reporters were generated that have seven canocical transcription factor binding motifs, instead of four and five as proiviously described (Sarrion-Perdigones et al., 2019). Destination vectors include five positional blue/white destination vectors for position A, B, C, D, and E, located in the final destination vector that provides a blue/white colorimetric screening marker (lacZ), and one pink/white final destination vector that provides a pink/white colorimetric screening marker (tinsel purple). (C) In the first step, novel pathway response elements are built, as described in Basic Protocol 2 or Alternate Protocol 1. (D) In the second step, novel custom luciferase reporter vectors are built in an alpha assembly, using the five positional blue/white destination vectors, pathway response element, luciferase, and transcriptional terminator, following Basic Protocol 3. (E) In the final step, a new multiplex hextuple luciferase reporter vector, consisting of four previously described pathway reporters (coupled to the luciferases RedF, FLuc, NLuc, and GrRenilla, respectively), one novel custom luciferase reporter (coupled to the luciferase Renilla in this case) and one control reporter (coupled to the luciferase ELuc), is generated as described in Basic Protocol 4. The same synthetic assembly pipeline can be tailored to incorporate any five previously described pathway reporters, any five novel custom luciferase reporters, or any combinations thereof, illustrating the versatility of the pipeline. (F-G) Comparison between the assembly cloning pipeline previously published stitching together 5xMyc:Renilla, 2xp53:Nluc, 4xTGFβ:FLuc, 6xMAPK:GrRenilla, CMV:ELuc, and 5xNFκβ:RedF luciferase reporters over five consecutive cloning reactions (Sarrion-Perdigones et al., 2019) (F), and the one presented here, stitching together 5xNFκβ:RedF, 7xTGFβ:FLuc, <t>3xDBE:Renilla,</t> 2xp53:Nluc, 6xMAPK:GrRenilla, and CMV:ELuc luciferase reporters using a single cloning reaction (G), illustrating a substantial decrease in time and money investment.
3xdbe Re, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3xdbe re/product/Addgene inc
Average 92 stars, based on 1 article reviews
3xdbe re - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc plasmids pcmv6 hph20 spam1
(A) DNA parts and destination vectors (Table 1) are ordered from the nonprofit plasmid repository Addgene as bacterial stabs, streaked on bacterial plates, grown up in culture, and prepared according to Basic Protocol 1. (B) DNA parts include pathway response elements consisting of a transcription blocker coupled to transcriptional response elements that can bind transcription factors specific for cellular pathways (e.g., NF-κβ, TGF-β, MAPK/JNK, c-Myc, or p53), five orthogonal luciferases (RedF, FLuc, NLuc, Renilla, and GrRenilla), and the transcriptional terminator/polyadenylation signal from the bovine growth hormone gene (bGHpA). Note that improved TGF-β and c-Myc pathway luciferase reporters were generated that have seven canocical transcription factor binding motifs, instead of four and five as proiviously described (Sarrion-Perdigones et al., 2019). Destination vectors include five positional blue/white destination vectors for position A, B, C, D, and E, located in the final destination vector that provides a blue/white colorimetric screening marker (lacZ), and one pink/white final destination vector that provides a pink/white colorimetric screening marker (tinsel purple). (C) In the first step, novel pathway response elements are built, as described in Basic Protocol 2 or Alternate Protocol 1. (D) In the second step, novel custom luciferase reporter vectors are built in an alpha assembly, using the five positional blue/white destination vectors, pathway response element, luciferase, and transcriptional terminator, following Basic Protocol 3. (E) In the final step, a new multiplex hextuple luciferase reporter vector, consisting of four previously described pathway reporters (coupled to the luciferases RedF, FLuc, NLuc, and GrRenilla, respectively), one novel custom luciferase reporter (coupled to the luciferase Renilla in this case) and one control reporter (coupled to the luciferase ELuc), is generated as described in Basic Protocol 4. The same synthetic assembly pipeline can be tailored to incorporate any five previously described pathway reporters, any five novel custom luciferase reporters, or any combinations thereof, illustrating the versatility of the pipeline. (F-G) Comparison between the assembly cloning pipeline previously published stitching together 5xMyc:Renilla, 2xp53:Nluc, 4xTGFβ:FLuc, 6xMAPK:GrRenilla, CMV:ELuc, and 5xNFκβ:RedF luciferase reporters over five consecutive cloning reactions (Sarrion-Perdigones et al., 2019) (F), and the one presented here, stitching together 5xNFκβ:RedF, 7xTGFβ:FLuc, <t>3xDBE:Renilla,</t> 2xp53:Nluc, 6xMAPK:GrRenilla, and CMV:ELuc luciferase reporters using a single cloning reaction (G), illustrating a substantial decrease in time and money investment.
Plasmids Pcmv6 Hph20 Spam1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmids pcmv6 hph20 spam1/product/Addgene inc
Average 93 stars, based on 1 article reviews
plasmids pcmv6 hph20 spam1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


Figure 5. AhR activation promotes the expression of α-defensin 1 via transcriptional binding of AhR to a DRE3 on α-defensin 1 promoter. (a) Identification of three DREs in α-defensin 1 promoter by in silico analysis. (b) 15p-1 and MC38 cells were transfected with pGL3-DRE1, pGL3-DRE2, pGL3-DRE3, and pGL3-DRE1 + 2 + 3 luciferase reporter plasmid and then treated with I3C and DSS at indicated concentration for 16hrs and luciferase reporter assays were performed (n = 4). (c) Same as A and B, but MC38 cells transiently transfected with AhR siRNA or control siRNA were used (n = 4). (d) The transfection efficiency of the reporter assay for AhR siRNA was measured via western blotting analysis with antibodies against AhR (upper panel) and RT-PCR analysis of AhR mRNA expression (bottom panel). All luciferase assays were normalized for transfection efficiency by renilla reporter activity. The results shown are a representative of four independent experiments performed each time in triplicate. (e) ChIP assay using AhR antibody

Journal: Gut microbes

Article Title: AhR Activation Transcriptionally Induces Anti-Microbial Peptide Alpha-Defensin 1 Leading to Reversal of Gut Microbiota Dysbiosis and Colitis.

doi: 10.1080/19490976.2025.2460538

Figure Lengend Snippet: Figure 5. AhR activation promotes the expression of α-defensin 1 via transcriptional binding of AhR to a DRE3 on α-defensin 1 promoter. (a) Identification of three DREs in α-defensin 1 promoter by in silico analysis. (b) 15p-1 and MC38 cells were transfected with pGL3-DRE1, pGL3-DRE2, pGL3-DRE3, and pGL3-DRE1 + 2 + 3 luciferase reporter plasmid and then treated with I3C and DSS at indicated concentration for 16hrs and luciferase reporter assays were performed (n = 4). (c) Same as A and B, but MC38 cells transiently transfected with AhR siRNA or control siRNA were used (n = 4). (d) The transfection efficiency of the reporter assay for AhR siRNA was measured via western blotting analysis with antibodies against AhR (upper panel) and RT-PCR analysis of AhR mRNA expression (bottom panel). All luciferase assays were normalized for transfection efficiency by renilla reporter activity. The results shown are a representative of four independent experiments performed each time in triplicate. (e) ChIP assay using AhR antibody

Article Snippet: Goat antimouse IgG (H+L) highly cross-adsorbed secondary antibody, Alexa FluorTM 488 (Cat# A-11029), goat anti-Mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa FluorTM 568 (Cat# A-11004), and goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody, Alexa FluorTM 568 (Cat# A-11011) were purchased from Thermo Fisher Scientific. pGL3-basic vector and renilla luciferase plasmids were obtained from Addgene.

Techniques: Activation Assay, Expressing, Binding Assay, In Silico, Transfection, Luciferase, Plasmid Preparation, Concentration Assay, Control, Reporter Assay, Western Blot, Reverse Transcription Polymerase Chain Reaction, Activity Assay

Journal: eLife

Article Title: The PMA phorbol ester tumor promoter increases canonical Wnt signaling via macropinocytosis

doi: 10.7554/eLife.89141

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , Renilla reporter (plasmid) , Addgene , RRID: Addgene_62186 , MuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module.

Techniques: Recombinant, Dominant Negative Mutation, Plasmid Preparation, Membrane, Luciferase, Expressing, Reporter Assay, Software, Imaging, Microinjection, Inverted Microscopy

(A) DNA parts and destination vectors (Table 1) are ordered from the nonprofit plasmid repository Addgene as bacterial stabs, streaked on bacterial plates, grown up in culture, and prepared according to Basic Protocol 1. (B) DNA parts include pathway response elements consisting of a transcription blocker coupled to transcriptional response elements that can bind transcription factors specific for cellular pathways (e.g., NF-κβ, TGF-β, MAPK/JNK, c-Myc, or p53), five orthogonal luciferases (RedF, FLuc, NLuc, Renilla, and GrRenilla), and the transcriptional terminator/polyadenylation signal from the bovine growth hormone gene (bGHpA). Note that improved TGF-β and c-Myc pathway luciferase reporters were generated that have seven canocical transcription factor binding motifs, instead of four and five as proiviously described (Sarrion-Perdigones et al., 2019). Destination vectors include five positional blue/white destination vectors for position A, B, C, D, and E, located in the final destination vector that provides a blue/white colorimetric screening marker (lacZ), and one pink/white final destination vector that provides a pink/white colorimetric screening marker (tinsel purple). (C) In the first step, novel pathway response elements are built, as described in Basic Protocol 2 or Alternate Protocol 1. (D) In the second step, novel custom luciferase reporter vectors are built in an alpha assembly, using the five positional blue/white destination vectors, pathway response element, luciferase, and transcriptional terminator, following Basic Protocol 3. (E) In the final step, a new multiplex hextuple luciferase reporter vector, consisting of four previously described pathway reporters (coupled to the luciferases RedF, FLuc, NLuc, and GrRenilla, respectively), one novel custom luciferase reporter (coupled to the luciferase Renilla in this case) and one control reporter (coupled to the luciferase ELuc), is generated as described in Basic Protocol 4. The same synthetic assembly pipeline can be tailored to incorporate any five previously described pathway reporters, any five novel custom luciferase reporters, or any combinations thereof, illustrating the versatility of the pipeline. (F-G) Comparison between the assembly cloning pipeline previously published stitching together 5xMyc:Renilla, 2xp53:Nluc, 4xTGFβ:FLuc, 6xMAPK:GrRenilla, CMV:ELuc, and 5xNFκβ:RedF luciferase reporters over five consecutive cloning reactions (Sarrion-Perdigones et al., 2019) (F), and the one presented here, stitching together 5xNFκβ:RedF, 7xTGFβ:FLuc, 3xDBE:Renilla, 2xp53:Nluc, 6xMAPK:GrRenilla, and CMV:ELuc luciferase reporters using a single cloning reaction (G), illustrating a substantial decrease in time and money investment.

Journal: Current protocols in molecular biology

Article Title: Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

doi: 10.1002/cpmb.121

Figure Lengend Snippet: (A) DNA parts and destination vectors (Table 1) are ordered from the nonprofit plasmid repository Addgene as bacterial stabs, streaked on bacterial plates, grown up in culture, and prepared according to Basic Protocol 1. (B) DNA parts include pathway response elements consisting of a transcription blocker coupled to transcriptional response elements that can bind transcription factors specific for cellular pathways (e.g., NF-κβ, TGF-β, MAPK/JNK, c-Myc, or p53), five orthogonal luciferases (RedF, FLuc, NLuc, Renilla, and GrRenilla), and the transcriptional terminator/polyadenylation signal from the bovine growth hormone gene (bGHpA). Note that improved TGF-β and c-Myc pathway luciferase reporters were generated that have seven canocical transcription factor binding motifs, instead of four and five as proiviously described (Sarrion-Perdigones et al., 2019). Destination vectors include five positional blue/white destination vectors for position A, B, C, D, and E, located in the final destination vector that provides a blue/white colorimetric screening marker (lacZ), and one pink/white final destination vector that provides a pink/white colorimetric screening marker (tinsel purple). (C) In the first step, novel pathway response elements are built, as described in Basic Protocol 2 or Alternate Protocol 1. (D) In the second step, novel custom luciferase reporter vectors are built in an alpha assembly, using the five positional blue/white destination vectors, pathway response element, luciferase, and transcriptional terminator, following Basic Protocol 3. (E) In the final step, a new multiplex hextuple luciferase reporter vector, consisting of four previously described pathway reporters (coupled to the luciferases RedF, FLuc, NLuc, and GrRenilla, respectively), one novel custom luciferase reporter (coupled to the luciferase Renilla in this case) and one control reporter (coupled to the luciferase ELuc), is generated as described in Basic Protocol 4. The same synthetic assembly pipeline can be tailored to incorporate any five previously described pathway reporters, any five novel custom luciferase reporters, or any combinations thereof, illustrating the versatility of the pipeline. (F-G) Comparison between the assembly cloning pipeline previously published stitching together 5xMyc:Renilla, 2xp53:Nluc, 4xTGFβ:FLuc, 6xMAPK:GrRenilla, CMV:ELuc, and 5xNFκβ:RedF luciferase reporters over five consecutive cloning reactions (Sarrion-Perdigones et al., 2019) (F), and the one presented here, stitching together 5xNFκβ:RedF, 7xTGFβ:FLuc, 3xDBE:Renilla, 2xp53:Nluc, 6xMAPK:GrRenilla, and CMV:ELuc luciferase reporters using a single cloning reaction (G), illustrating a substantial decrease in time and money investment.

Article Snippet: Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator.

Techniques: Plasmid Preparation, Luciferase, Generated, Binding Assay, Marker, Multiplex Assay, Clone Assay

Summary of vectors described in this work.

Journal: Current protocols in molecular biology

Article Title: Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

doi: 10.1002/cpmb.121

Figure Lengend Snippet: Summary of vectors described in this work.

Article Snippet: Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator.

Techniques: Plasmid Preparation, Luciferase, Binding Assay, Multiplex Assay

(A) Overview of the in silico scarless assembly of a a luciferase reporter transcriptional unit in the destination plasmid Alpha C. Three “part” plasmids, TB:3xDBE:MiniP (Addgene #124529), pRenilla luciferase (Addgene #124529) and bGHpA (Addgene #118061), and the destination vector AlphaC are incubated with BsaI and T4 DNA ligase. Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator. A second type IIs restriction enzyme, BsmBI, can be used for diagnostic DNA fingerprinting, and will also be used to release the 3xDBE_RE::Renilla fragment during the next round of assembly when multiple luciferase reporter transcriptional units will be stitched together (see Basic protocol 4 and Figure 6). Assembled plasmids are identified as white colored colonies that are characterized further (see D), while religated AlphaC plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of each of the parts to be assembled (TB:3xDBE:MiniP, pRenilla luciferase #124529 and bGHpA #118061), 75 ng of the AlphaC destination vector, the type IIs restriction enzyme BsaI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 2 white colored colonies using EcoRI/SphI (2521, 1014 and 334 bp) and KpnI/StyI (2304, 1176 and 389 bp), and uncut DNA. Both colonies show the correct digestion pattern.

Journal: Current protocols in molecular biology

Article Title: Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

doi: 10.1002/cpmb.121

Figure Lengend Snippet: (A) Overview of the in silico scarless assembly of a a luciferase reporter transcriptional unit in the destination plasmid Alpha C. Three “part” plasmids, TB:3xDBE:MiniP (Addgene #124529), pRenilla luciferase (Addgene #124529) and bGHpA (Addgene #118061), and the destination vector AlphaC are incubated with BsaI and T4 DNA ligase. Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator. A second type IIs restriction enzyme, BsmBI, can be used for diagnostic DNA fingerprinting, and will also be used to release the 3xDBE_RE::Renilla fragment during the next round of assembly when multiple luciferase reporter transcriptional units will be stitched together (see Basic protocol 4 and Figure 6). Assembled plasmids are identified as white colored colonies that are characterized further (see D), while religated AlphaC plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of each of the parts to be assembled (TB:3xDBE:MiniP, pRenilla luciferase #124529 and bGHpA #118061), 75 ng of the AlphaC destination vector, the type IIs restriction enzyme BsaI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 2 white colored colonies using EcoRI/SphI (2521, 1014 and 334 bp) and KpnI/StyI (2304, 1176 and 389 bp), and uncut DNA. Both colonies show the correct digestion pattern.

Article Snippet: Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator.

Techniques: In Silico, Luciferase, Plasmid Preparation, Incubation, Diagnostic Assay, DNA Profiling, Clone Assay, Ligation

(A) Overview of the in silico scarless assembly of a multiplex luciferase reporter in the destination vector Omega Destination-CMV:ELuc:bGH. Five “transcriptional reporter” plasmids, AlphaA 5xNF-KB:RedF:bGHpA (Addgene #124530) reporting on NF-κβ pathway signaling using red firefly luciferase (RF), AlphaB 7xSMAD:FLuc:bGHpA (Addgene #124531) reporting on TGF-β signaling using firefly luciferase (FL), AlphaC 3xDBE:Renilla:bGHpA (Addgene #124535) reporting on FoxO pathway signaling using renilla luciferase (Re), AlphaD 2xp53:NLuc:bGHpA (Addgene #124533) reporting on p53 pathway signaling using nano luciferase (NL), and AlphaE 6xAP1_RE:GrRenilla:bGHpA (Addgene #124534) reporting on MAPK/JNK pathway signaling using green renilla luciferase (GR), as well as the destination vector Omega Destination-CMV:ELuc:bGH containing the control enhanced beetle luciferase (EL) for normalization purposes are incubated together with BsmBI and T4 DNA ligase. Correct multipartitie stitching of all five BsmBI-released transcriptional luciferase reporter units into BsmBI-opended Omega Destination-CMV:ELuc:bGH, results in the final multiplex luciferase vector MLRV2:NF-kb-SMAD-DBE-P53-AP1 (Addgene #124536), consisting of five transcriptional luciferase reporter units stitched together in a specified order, and one control luciferase reporter unit (constitutively expressed ELuc luciferase). Assembled plasmids are identified as white colored colonies that are characterized further (see C), while religated Omega Destination-CMV:ELuc:bGH plasmids are pink to purple colored due to the presence of the colorimetric marker, tinsel purple. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of the final pink/white destination vector (Omega Destination-CMV:ELuc:bGH), 75 ng of each of the luciferase entry vectors, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C and 16°C. (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 3 white colored colonies using ScaI (6510, 2219, 1790, 1543, 1088 and 486 bps) and XhoI (6500, 2263, 1508, 1098, 979, 794 and 494 bps), and uncut DNA. All colonies show the correct digestion pattern.

Journal: Current protocols in molecular biology

Article Title: Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

doi: 10.1002/cpmb.121

Figure Lengend Snippet: (A) Overview of the in silico scarless assembly of a multiplex luciferase reporter in the destination vector Omega Destination-CMV:ELuc:bGH. Five “transcriptional reporter” plasmids, AlphaA 5xNF-KB:RedF:bGHpA (Addgene #124530) reporting on NF-κβ pathway signaling using red firefly luciferase (RF), AlphaB 7xSMAD:FLuc:bGHpA (Addgene #124531) reporting on TGF-β signaling using firefly luciferase (FL), AlphaC 3xDBE:Renilla:bGHpA (Addgene #124535) reporting on FoxO pathway signaling using renilla luciferase (Re), AlphaD 2xp53:NLuc:bGHpA (Addgene #124533) reporting on p53 pathway signaling using nano luciferase (NL), and AlphaE 6xAP1_RE:GrRenilla:bGHpA (Addgene #124534) reporting on MAPK/JNK pathway signaling using green renilla luciferase (GR), as well as the destination vector Omega Destination-CMV:ELuc:bGH containing the control enhanced beetle luciferase (EL) for normalization purposes are incubated together with BsmBI and T4 DNA ligase. Correct multipartitie stitching of all five BsmBI-released transcriptional luciferase reporter units into BsmBI-opended Omega Destination-CMV:ELuc:bGH, results in the final multiplex luciferase vector MLRV2:NF-kb-SMAD-DBE-P53-AP1 (Addgene #124536), consisting of five transcriptional luciferase reporter units stitched together in a specified order, and one control luciferase reporter unit (constitutively expressed ELuc luciferase). Assembled plasmids are identified as white colored colonies that are characterized further (see C), while religated Omega Destination-CMV:ELuc:bGH plasmids are pink to purple colored due to the presence of the colorimetric marker, tinsel purple. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of the final pink/white destination vector (Omega Destination-CMV:ELuc:bGH), 75 ng of each of the luciferase entry vectors, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C and 16°C. (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 3 white colored colonies using ScaI (6510, 2219, 1790, 1543, 1088 and 486 bps) and XhoI (6500, 2263, 1508, 1098, 979, 794 and 494 bps), and uncut DNA. All colonies show the correct digestion pattern.

Article Snippet: Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator.

Techniques: In Silico, Multiplex Assay, Luciferase, Plasmid Preparation, Incubation, Marker, Clone Assay

(A) A first go at the to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP): both parts of the transcription blocker are indicated in grey, the FoxO DNA binding part is indicated in red, while the minimal promoter is indicated in black. (B) Overview schematic of the FoxO pathway response element (TB:3xDBE_RE:MiniP) highlighting the three parts: a transcription blocker (TB) part containing a synthetic polyA terminator (poly(A)) and the RNA polymerase II transcriptional pause signal from the human α2 globin gene (pause site), a FoxO DNA binding part consisting of three tandem FOXO response elements (3xDBE), and a minimal promoter (MiniP) part. (C) Close-up of the FoxO DNA binding part, highlighting three repetitive copies of the FoxO response element, DBE, all canonical FoxO-binding motifs (GATCAAGTAAACAACTATGTAAACAA) spaced by random nucleotides, and the recognition site for the type II restriction enzyme EcoRI to perform diagnostic DNA fingerprinting. (D) Detailed schematic of the initial to-be-synthetized FoxO pathway response element fragment (TB:3xDBE_RE:MiniP) highlighting the appropriate binding sites for the type IIs restriction enzyme BsmBI. Fragments with such repetitive nature often do not fulfill the requirements needed for successful DNA synthesis and can’t be ordered from commercial vendors. (E) Modified schematic of the FoxO pathway response element fragment, which incorporates two additional BsmBI spacers that disrupt the DBE repeats, reducing the repetitive nature and fulfilling the requirements needed for successful synthesis of the fragment by commercial vendors. Internal overhangs decided on for Type IIs restriction enzyme mediated assembly of the three DBE repeats are AACA and CAAC (see F). (F) Ligase fidelity chart, according to the NEB Tool (http://tools.neb.com/~potapov/cgi-bin/ligase-fidelity-viewer (Potapov et al., 2018b, 2018a)). Annealing and ligation fidelity of the chosen overhangs, CTCG/CGAG (Vector/DBE1 annealing), AACA/TGTT (DBE1/DBE1 annealing), CAAC/GTTG (DBE3/DBE3 annealing), and CGAG/CTCG (DBE3/Vector annealing), is estimated at 100% with minimal trace mismatch. (G) The to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP) with reduced repetitive nature: the FoxO DNA binding part, indicated in red, is now interrupted with two spacers (see E). (H) Overview of the in silico scarless assembly of the fragment in the domesticator plasmid pUPD3 (Universal Part Domesticator plasmid 3) using BsmBI and T4 DNA ligase, resulting in the final plasmid, pTB:3xDBE_RE:MiniP. The synthetic FoxO pathway response element (TB:3xDBE_RE:MiniP) will be cut into three smaller DNA fragments that after annealing and ligating will result in the precise reconstitution of the three repetitive copies of the FoxO response element DBE (see A). A second type IIs restriction enzyme, BsaI, is used for diagnostic DNA fingerprinting (see K), and will also be used to release the TB:3xDBE_RE:MiniP fragment during the next round of assembly when luciferase reporter transcriptional units will be stitched together (see Basic protocol 3 and Figure 5). Assembled plasmids are identified as white colored colonies that are characterized further (see K), while religated pUPD3 plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (I) Overview of the cloning reaction. Prepare a reaction mix containing 2 μL obtained synthetized fragment, 75 ng of pUPD3 domesticator plasmid, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (J) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (K) Restriction enzyme digestions of 4 white colored colonies using EcoRI (2997, 233, 196 bp) or BsaI (3057, 369 bp), and uncut DNA. Three colonies show the correct digestion pattern, the fourth had probably incorporated only one of the three fragments.

Journal: Current protocols in molecular biology

Article Title: Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

doi: 10.1002/cpmb.121

Figure Lengend Snippet: (A) A first go at the to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP): both parts of the transcription blocker are indicated in grey, the FoxO DNA binding part is indicated in red, while the minimal promoter is indicated in black. (B) Overview schematic of the FoxO pathway response element (TB:3xDBE_RE:MiniP) highlighting the three parts: a transcription blocker (TB) part containing a synthetic polyA terminator (poly(A)) and the RNA polymerase II transcriptional pause signal from the human α2 globin gene (pause site), a FoxO DNA binding part consisting of three tandem FOXO response elements (3xDBE), and a minimal promoter (MiniP) part. (C) Close-up of the FoxO DNA binding part, highlighting three repetitive copies of the FoxO response element, DBE, all canonical FoxO-binding motifs (GATCAAGTAAACAACTATGTAAACAA) spaced by random nucleotides, and the recognition site for the type II restriction enzyme EcoRI to perform diagnostic DNA fingerprinting. (D) Detailed schematic of the initial to-be-synthetized FoxO pathway response element fragment (TB:3xDBE_RE:MiniP) highlighting the appropriate binding sites for the type IIs restriction enzyme BsmBI. Fragments with such repetitive nature often do not fulfill the requirements needed for successful DNA synthesis and can’t be ordered from commercial vendors. (E) Modified schematic of the FoxO pathway response element fragment, which incorporates two additional BsmBI spacers that disrupt the DBE repeats, reducing the repetitive nature and fulfilling the requirements needed for successful synthesis of the fragment by commercial vendors. Internal overhangs decided on for Type IIs restriction enzyme mediated assembly of the three DBE repeats are AACA and CAAC (see F). (F) Ligase fidelity chart, according to the NEB Tool (http://tools.neb.com/~potapov/cgi-bin/ligase-fidelity-viewer (Potapov et al., 2018b, 2018a)). Annealing and ligation fidelity of the chosen overhangs, CTCG/CGAG (Vector/DBE1 annealing), AACA/TGTT (DBE1/DBE1 annealing), CAAC/GTTG (DBE3/DBE3 annealing), and CGAG/CTCG (DBE3/Vector annealing), is estimated at 100% with minimal trace mismatch. (G) The to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP) with reduced repetitive nature: the FoxO DNA binding part, indicated in red, is now interrupted with two spacers (see E). (H) Overview of the in silico scarless assembly of the fragment in the domesticator plasmid pUPD3 (Universal Part Domesticator plasmid 3) using BsmBI and T4 DNA ligase, resulting in the final plasmid, pTB:3xDBE_RE:MiniP. The synthetic FoxO pathway response element (TB:3xDBE_RE:MiniP) will be cut into three smaller DNA fragments that after annealing and ligating will result in the precise reconstitution of the three repetitive copies of the FoxO response element DBE (see A). A second type IIs restriction enzyme, BsaI, is used for diagnostic DNA fingerprinting (see K), and will also be used to release the TB:3xDBE_RE:MiniP fragment during the next round of assembly when luciferase reporter transcriptional units will be stitched together (see Basic protocol 3 and Figure 5). Assembled plasmids are identified as white colored colonies that are characterized further (see K), while religated pUPD3 plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (I) Overview of the cloning reaction. Prepare a reaction mix containing 2 μL obtained synthetized fragment, 75 ng of pUPD3 domesticator plasmid, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (J) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (K) Restriction enzyme digestions of 4 white colored colonies using EcoRI (2997, 233, 196 bp) or BsaI (3057, 369 bp), and uncut DNA. Three colonies show the correct digestion pattern, the fourth had probably incorporated only one of the three fragments.

Article Snippet: Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator.

Techniques: Synthesized, Sequencing, Binding Assay, Diagnostic Assay, DNA Profiling, DNA Synthesis, Modification, Ligation, Plasmid Preparation, In Silico, Luciferase, Clone Assay, Incubation